After reading the AANP (2015) and White, et al. (2017) articles, what are your thoughts on the economic benefits of using nurse practitioners in

Question After reading the AANP (2015) and White, et al. (2017) articles, whatare your thoughts on the economic benefits of using nurse practitioners in healthcare practices? How would you respond to this question if asked in a job interview? Support your response in Part 3 with evidence from the literature.Please help answer this question Health Science Science Nursing Share QuestionEmailCopy link Comments (0)

Provide a detailed explanation, including the significance of The…

Question Answered step-by-step Provide a detailed explanation, including the significance of The… Provide a detailed explanation, including the significance of The EC Bananas Case (European Communities – Regime for theimportation, Sale and Distribution of Bananas (WTO Appellate Body, May 1997).Minimum 1 page double-space. All sources MUST be cited.Instructions for submission: Submit assignment via BlackBoard.Due date: June 5, 2022 Business Management SIB 520 Share QuestionEmailCopy link Comments (0)

list the five policies and procedures relevant to providing care of…

Question list the five policies and procedures relevant to providing care of… list the five policies and procedures relevant to providing care of the client with disability Health Science Science Nursing BEHS 320 Share QuestionEmailCopy link Comments (0)

Solve Questions 2-6 Only.

Question Answered step-by-step Solve Questions 2-6 Only. Image transcription text2. List 3 differences between DNA and RNA. a h C. 3. What is the difference between purines and pyrimidines?4. Which bases form base pairs together on opposite DNA strands? 5. Which base pairs with adenine in RNAstrands? 6. In the diagram below, label all of the 3′ and 5′ ends. a. TCGACGGATCAGATGACGGAT… Show more… Show more Solve Questions 2-6 Only.    Science Biology BIO 4U Share QuestionEmailCopy link Comments (0)

Why strategies important to use by APRN in their practice and why…

Question Answered step-by-step Why strategies important to use by APRN in their practice and why… Why strategies important to use by APRN in their practice and why do they need to review and critique literature pertinent to their practice.Please include references,, Thanks! Health Science Science Nursing NURSING 590 DQ2 WK Share QuestionEmailCopy link Comments (0)

RN. Identify two ways in which you will continue to integrate evidence into your practice and encourage it within your work environment. What obstacles could challenge this plan, and what steps will you take to minimize their impact? Aljasmi, F., Almalood, F., & Al Ansari, A. (2018). Prevalence of medication errors in primary health care at Bahrain Defence Force Hospital-prescription-based study. Drug, healthcare and patient safety, 10, 1. http://dx.doi.org/10.1136/bmjopen-2017-019101Bakhshi, F., Mitchell, R., Nikbakht Nasrabadi, A., Javadi, M., & Varaei, S. (2021). Clinician attitude towards safety in medication management: a participatory action research study in an emergency department. BMJ Open, 11(9), e047089. https://doi.org/10.1136/bmjopen-2020-047089 Farzi, S., Irajpour, A., Saghaei, M., & Ravaghi, H. (2017). Causes of Medication Errors in Intensive Care Units from the Perspective of Healthcare Professionals. Journal of research in pharmacy practice, 6(3), 158-165. https://doi.org/10.4103/jrpp.JRPP_17_47 Irajpour, A., Farzi, S., Saghaei, M., & Ravaghi, H. (2019). Effect of interprofessional education of medication safety program on the medication error of physicians and nurses in the intensive care units. Journal of education and health promotion, 8, 196. https://doi.org/10.4103/jehp.jehp_200_19

Question Answered step-by-step Discuss why EBP is an essential component of the practice of a BSN-preparedRN. Identify two ways in which you will continue to integrate evidence into your practice and encourage it within your work environment. What obstacles could challenge this plan, and what steps will you take to minimize their impact? Aljasmi, F., Almalood, F., & Al Ansari, A. (2018). Prevalence of medication errors in primary health care at Bahrain Defence Force Hospital-prescription-based study. Drug, healthcare and patient safety, 10, 1. http://dx.doi.org/10.1136/bmjopen-2017-019101Bakhshi, F., Mitchell, R., Nikbakht Nasrabadi, A., Javadi, M., & Varaei, S. (2021). Clinician attitude towards safety in medication management: a participatory action research study in an emergency department. BMJ Open, 11(9), e047089. https://doi.org/10.1136/bmjopen-2020-047089 Farzi, S., Irajpour, A., Saghaei, M., & Ravaghi, H. (2017). Causes of Medication Errors in Intensive Care Units from the Perspective of Healthcare Professionals. Journal of research in pharmacy practice, 6(3), 158-165. https://doi.org/10.4103/jrpp.JRPP_17_47 Irajpour, A., Farzi, S., Saghaei, M., & Ravaghi, H. (2019). Effect of interprofessional education of medication safety program on the medication error of physicians and nurses in the intensive care units. Journal of education and health promotion, 8, 196. https://doi.org/10.4103/jehp.jehp_200_19 Health Science Science Nursing NRS 493 Share QuestionEmailCopy link Comments (0)

Identify at least two current trends in this topic area and…

Question Identify at least two current trends in this topic area and… Identify at least two current trends in this topic area and evaluate their relevance to your area of professional practice. Health Science Science Nursing NURSING CHCPOL003 Share QuestionEmailCopy link Comments (0)

Compare how Girl by Jamaica Kincaid and Their eyes were watching…

Question Answered step-by-step Compare how Girl by Jamaica Kincaid and Their eyes were watching… Compare how Girl by Jamaica Kincaid and Their eyes were watching God by Zora Neale Hurston,both demonstrate the theme of the problematic nature of gender roles. Include at least 3 literary devicesExplain how both texts show this theme,Include text evidence Address the poem,Janie,Nanny and at least one of her marriages. Arts & Humanities Writing Creative Writing ENGLISH 1301 Share QuestionEmailCopy link Comments (0)

Please check the context of my writing (Please check my sentences…

Question Answered step-by-step Please check the context of my writing (Please check my sentences… Please check the context of my writing (Please check my sentences and grammar.) A 33-year-old female Asian patient’s baseline of vital signs was BP: 129/78 P:72 R:16 O2: 98% T: 96. 4 F and BMI was 31.1. According to medical history, the patient was ASAII due to an allergy to latex, WLAC Calculus Code: 2 Light, and AAP Stage I (P-1) and Grade A due to Generalized 1-2mm with horizontal bone loss. The patient’s overall treatment outcome improved from the initial visit. The patient presented improvement with MBI 0%, a significant reduction of 16%. However, there was little difference between before and after evaluated plaque management and recording. Between tooth and tooth area was the least managed. Probing depths improved generalized 2mm and 3mm with less localized 4mm. Surface of improvement from 4mm pockets to 3mm or 2mm pockets include teeth #3, #13, #15, #20, and #30. The probing depths were taken 5 weeks after the last scaling appointment.  The Patient had a thorough understanding of nutrition pre and post-treatment. After re-evaluation on May 17, 2022, the BMI was 25.6, indicating that the patient’s weight falls into the category of overweight adults for the patient’s height. The patient worked hard to lose weight. The patient currently weighs 140 pounds, so losing an additional 4 pounds will put the patient in a healthy weight range. After consultation, the total amount and percentage of macronutrients increased. However, the patient’s total macronutrients were still below the essential recommended dietary allowance (RDA). The patient is taking a women’s multivitamin daily. In general, intake of vitamins and minerals that were insufficient should be taken in the recommended amount. But vitamin E and minerals: calcium and magnesium still need to be increased. The patient increases consumed 7-9 cups of water per day for 3 days and tried to control sodium intake. As a result, they did not exceed the recommended daily intake of sodium. The patient is required to have 4 appointments to remove of accumulation of plaque biofilm and calculus. The patient received one scaling appointment to remove light sub and supra interproximal calculus and plaque biofilm removal. The only modification recommendation would be to allow more healing time in between the last scaling appointment and the reassessment appointment, to obtain more accuracy in the healing of the tissues. Fluoride varnish was provided at the last scaling appointment with the polishing of the teeth. In addition, every 3 months periodontal maintenance is required for the patient to maintain periodontal conditions and control plaque biofilm. The goals for this patient was to remove light sub and supra interproximal calculus and plaque biofilm removal, reduce pocket depths. During the re-evaluation appointment, the oral hygiene has been improved due to the great cooperation of oral hygiene instruction. Probing depths improved generalized 2mm and 3mm with less localized 4mm. Surface of improvement from 4mm pockets to 3mm or 2mm pockets include teeth #3, #13, #15, #20, and #30. Post MBI index calculated at 0%. The patient improved 16% from the initial MBI index. However, there was little difference between before and after evaluated plaque management and recording. Between tooth and tooth area was the least managed, and the importance of OHI to patients should be known once again. The patient followed my recommendations daily to use an electric toothbrush and dental floss. However, the use of dental floss was still inexperienced, so training in flossing technique was necessary once again. It was a small change, but it has significantly reduced bleeding gums with these changes. This result means that the patient’s gum health has improved and the inflammation in the gums has disappeared.                                                             Health Science Science Nursing NUTRITION 300 Share QuestionEmailCopy link Comments (0)