Run a python program that will: a. Read a text file (input.txt)…
Question Answered step-by-step Run a python program that will: a. Read a text file (input.txt)… Run a python program that will:a. Read a text file (input.txt) that contains two lines wherein the first line is a normal DNA sequence, while the second line is a mutated DNA sequence.b. The program must also transcribe and translate the sequences by providing outputs for their respective mRNA and protein products. *** input.txt ***ATGGTCAGAACGCGCTGAAATGGTTAGAACGCGCTGAC *** your.py ***Normal RNA Sequence: UACCAGUCUUGCGCGACUUMutated RNA Sequence: UACCAAUCUUGCGCGACUG Normal Protein Sequence: Try Gln Ser Cys Ala ThrMutated Protein Sequence: Try Gln Ser Cys Ala ThrPlease send me answer fast. Computer Science Engineering & Technology Python Programming Share QuestionEmailCopy link Comments (0)
